Journal: Bio-protocol

Article Title: Assembly and Mutagenesis of Human Coronavirus OC43 Genomes in Yeast via Transformation-Associated Recombination

doi: 10.21769/BioProtoc.5422

Figure Lengend Snippet: (A) Following the identification of a site (orange asterisk) for mutagenesis in silico, a DNA endonuclease is used to introduce a dsDNA break at or near the site for mutagenesis. A dsDNA homology-directed repair (HDR) fragment is designed carrying the mutagenized sequence with flanking homology regions (light blue rectangles) to sequences flanking the mutagenesis site in the HCoV-OC43-YCpBAC. The linearized HCoV-OC43-YCpBAC and the HDR fragment are co-transformed into yeast to create the mutated plasmid. (B) The yeast carrying the re-circularized HCoV-OC43-YCpBAC (maroon colonies) are selected on plates lacking uracil due to the orotidine 5-phosphate decarboxylase (URA ) gene present in the YCpBAC. Yeast are patched onto SD-URA plates, and then colony PCRs are performed using primers (dark blue arrows) flanking the HDR fragment/YCpBAC junctions to identify correct transformants. (C) Yeast with the correctly mutated HCoV-OC43-YCpBAC are grown in liquid cultures lacking uracil, from which total yeast DNA is isolated and used to transform Escherichia coli with plasmid selection via chloramphenicol acetyltransferase ( CAM ) expression from the YCpBAC. (D) The mutated HCoV-OC43-YCpBAC is then transfected into 293T cells, followed by a co-culture with BHK-21 cells, to rescue mutant viruses.

Article Snippet: Virus: Betacoronavirus 1 strain OC43 (HCoV-OC43) (ATCC, catalog number: VR-1558), storage: -80 °C 7.

Techniques: Mutagenesis, In Silico, Introduce, Sequencing, Transformation Assay, Plasmid Preparation, Isolation, Selection, Expressing, Transfection, Co-Culture Assay

Journal: Bio-protocol

Article Title: Assembly and Mutagenesis of Human Coronavirus OC43 Genomes in Yeast via Transformation-Associated Recombination

doi: 10.21769/BioProtoc.5422

Figure Lengend Snippet: The HCoV-OC43-YCpBACs described in this protocol are designed for virus rescue in mammalian cells. Upstream of the HCoV-OC43 5′ untranslated region (5′ UTR) sequence is a human cytomegalovirus promoter (CMVpro; blue highlighted region) sequence to initiate mRNA transcription. HCoV-OC43-YCpBACs reporter genes ( Rep ) are inserted in the intergenic region between the M and N genes under the control of the N transcription regulatory sequence ( TRS, TRS for Rep sgRNA; maroon-highlighted region). The N gene in these reporter virus genomes is under the control of a duplicated version of the N TRS (TRS* ; maroon-highlighted region). Immediately 3′ to the HCoV-OC43 3′ UTR sequence is an encoded poly(A) sequence followed by a hepatitis delta virus ribozyme (HDV ribozyme) sequence (teal-highlighted region) to generate mRNAs terminating in poly(A) sequences following transcription in mammalian cells. Downstream of the HDV ribozyme is a bovine growth hormone polyadenylation [BGH poly(A)] signal (teal-highlighted region) to facilitate mRNA transcription termination.

Article Snippet: Virus: Betacoronavirus 1 strain OC43 (HCoV-OC43) (ATCC, catalog number: VR-1558), storage: -80 °C 7.

Techniques: Virus, Sequencing, Control

Journal: Bio-protocol

Article Title: Assembly and Mutagenesis of Human Coronavirus OC43 Genomes in Yeast via Transformation-Associated Recombination

doi: 10.21769/BioProtoc.5422

Figure Lengend Snippet: The CMVn-OC43-WT-Ribo-BGH-YCpBAC was digested with Pme I and I- Sce I to generate the YCpBAC fragment for TAR mutagenesis to insert the mRuby-H2B reporter gene into the OC43 genome. The HDR fragment carrying the reporter gene was generated from Sal I/ Sgr AI digestion of OC43TAR456-mRuby-YCpBAC. The regions of homology to direct plasmid assembly are shown with orange circles ( NS2A-S ) and blue circles ( cos ). The greyed-out sections of the plasmids did not contribute to the assembly of CMVn-OC43-mRuby-Ribo-BGH-YCpBAC. All restriction endonuclease sites are underlined.

Article Snippet: Virus: Betacoronavirus 1 strain OC43 (HCoV-OC43) (ATCC, catalog number: VR-1558), storage: -80 °C 7.

Techniques: Mutagenesis, Generated, Plasmid Preparation

Journal: Bio-protocol

Article Title: Assembly and Mutagenesis of Human Coronavirus OC43 Genomes in Yeast via Transformation-Associated Recombination

doi: 10.21769/BioProtoc.5422

Figure Lengend Snippet: (A) HEK 293A cells infected at an MOI of 0.1 for 1 h in serum-free medium with the indicated viruses, followed by a medium change to 2.5% DMEM+PSQ prior to collection of the supernatants at the indicated times. The virus-containing supernatants were titred on BHK-21 cells with five-fold serial dilutions using the TCID50 (Spearman-Kärber [41]) method. Data were plotted as the mean ± standard deviation from three biological replicates. No significant differences were obtained using two-way ANOVA (Tukey). (B) Total RNA from cells infected as in panel A was isolated using the RNeasy Plus Mini Kit (QIAGEN) and reverse transcribed using Maxima H Minus First Strand cDNA Synthesis Kit (Thermo Fisher) with random hexamers and oligo (dT)18 primers. qPCRs were performed using Luna Universal qPCR Master Mix (NEB) in 10 μL reactions with 200 nM primers [forward (Orf1a/N): 5′ CCGCTTCACTGATCTCTTG, reverse (Orf1a): 5′ ACCACTATGAAAAATCTACGCC, reverse (N): 5′ GAGGACGCTCTACTACTGG, forward (18S): 5′ TTCGAACGTCTGCCCTATCAA, reverse (18S): 5′ GATGTGGTAGCCGTTTCTCAGG] and 1:600 diluted cDNA. Analysis was performed using an efficiency-corrected 2−ΔΔCq method [42] with the level of expression of Orf1a (left panel) or N (right panel) relative to 18S plotted as the mean ± standard deviation from three biological replicates. Statistical significance was determined using two-way ANOVA (Tukey) and *P ≤ 0.0001. (C) Lysates from cells infected as in panel A were prepared with 2× Laemmli buffer containing dithiothreitol/bromophenol blue, and 5 μg per lane was separated on 10% acrylamide gels prior to transfer to polyvinylidene fluoride membranes using the Trans-Blot Turbo RTA Midi 0.2 μm PVDF Transfer Kit (Bio-Rad) and a Trans-Blot Turbo Transfer System (Bio-Rad). 4% bovine serum albumin in Tris-buffered saline containing 0.1% Tween-20 was used for membrane blocking and antibody incubations. The following antibodies were used: Mouse anti-OC43-N (1:2,500); rabbit anti-OC43-S (1:2,000); rabbit anti-OC43-HE (1:500); rabbit anti-β-Actin (1:1,000), goat anti-mouse IgG, Alexa Fluor 555 (1:10,000); goat anti-rabbit IgG, Alexa Fluor 647 (1:10,000); and goat anti-rabbit IgG, Alexa Fluor 488 (1:10,000). (D) Total RNA samples from cells infected as in panel A were isolated using the RNeasy Plus Mini Kit (QIAGEN) and separated on a 1% denaturing agarose gel containing ethidium bromide also loaded with a ssRNA ladder (NEB) (left panel). Following alkaline transfer and UV cross-linking of the RNA, the RNA blot was incubated with 25 nM biotinylated oligo probe (5′ Biotin-GCCTCATCGCTACTTGGGTCCCGATCGACAATGTCAGCCGGGGT) in hybridization solution overnight at 42 °C. Streptavidin-HRP (1:2,500) diluted in Odyssey Blocking Buffer (LI-COR) containing 1% sodium lauryl sulfate was incubated with the blot for 1 h at room temperature prior to detection using Clarity Max Western ECL Substrate (Bio-Rad) and a ChemiDoc MP Imaging System (Bio-Rad) (right panel). Abbreviations: Chemi, chemiluminescence; HE, hemagglutinin esterase; hpi, hours post-infection; HRP, horseradish peroxidase; kb, kilobases; kDa, kilodaltons; mCard, mCardinal; mClo, mClover; MOI, multiplicity of infection; N, nucleocapsid; Orf1a, open reading frame 1a; S, Spike; TCID50, 50% tissue culture infectious dose; YA, yeast-assembled.

Article Snippet: Virus: Betacoronavirus 1 strain OC43 (HCoV-OC43) (ATCC, catalog number: VR-1558), storage: -80 °C 7.

Techniques: Infection, Virus, Standard Deviation, Isolation, Reverse Transcription, cDNA Synthesis, Expressing, Saline, Membrane, Blocking Assay, Agarose Gel Electrophoresis, Northern blot, Incubation, Hybridization, Western Blot, Imaging

Journal: iScience

Article Title: Flowtigs: Safety in flow decompositions for assembly graphs

doi: 10.1016/j.isci.2024.111208

Figure Lengend Snippet:

Article Snippet: Our experiments with real data were performed on the ZymoBIOMICS Gut Microbiome Standard dataset (henceforth referred to by Zymo), a microbial community that mimics the human gut microbiome.

Techniques: Software